T19 Primer Detail MGI Mouse MGI:571

T19 Primer Detail

Name

T19
Primer 1 Sequence

CTGCATGCACTGTATTTGTAT
Primer 2 Sequence

ACTCATGGGTTGTGCATATGG
ID

MGI:571
Product Size

180bp
Synonyms

TJ-T23

D2Nds1

DNA segment, Chr 2, Nuffield Department of Surgery 1

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D2Nds1	a	larger	AKR/J
	h	large	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7
	n	largest	DBA/2J, NOD
	o	smallest	NON
	s	smaller	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D2Nds1	d	185bp	BALB/cJ, DBA/2J, LP/J
	e	178bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	158bp	CAST/EiJ
	i	152bp	NON/ShiLt
	j	188bp	NOD/MrkTac
	s	182bp	A/J, AKR/J, C3H/HeJ, SPRET/EiJ

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23