About   Help   FAQ
Fbxl11-pA, Fbxl11-pB Primer Detail
Primers
  • Name
    Fbxl11-pA, Fbxl11-pB
  • Primer 1 Sequence
    GCCAAGGCACTTGAAAGAAA
  • Primer 2 Sequence
    AGCAGCCTCGAACACTCATT
  • ID
    MGI:5698094
Genes
Kdm2a lysine (K)-specific demethylase 2A
Expression
  • Assay Results
    14
References
J:217589 Kawakami E, et al., The histone demethylase Fbxl11/Kdm2a plays an essential role in embryonic development by repressing cell-cycle regulators. Mech Dev. 2015 Feb;135:31-42

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory