About   Help   FAQ
Nxf3-pA, Nxf3-pB Primer Detail
Primers
  • Name
    Nxf3-pA, Nxf3-pB
  • Primer 1 Sequence
    CAATCCCAACATTGCCTTTATGC
  • Primer 2 Sequence
    CTGCCGATCTCCATTGTCATAG
  • ID
    MGI:5646591
Genes
Nxf3 nuclear RNA export factor 3
Expression
  • Assay Results
    9
References
J:200621 Vanmarsenille L, et al., Generation and characterization of an Nxf7 knockout mouse to study NXF5 deficiency in a patient with intellectual disability. PLoS One. 2013;8(5):e64144

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory