About   Help   FAQ
Zp2-pG, Zp2-pH Primer Detail
Primers
  • Name
    Zp2-pG, Zp2-pH
  • Primer 1 Sequence
    TGGCAATGGTACAAGAGCC
  • Primer 2 Sequence
    TCACTGTGGATAGCATGTTCC
  • ID
    MGI:5637970
  • Region Covered
    nucleotides 576-1075 of M34148
Genes
Zp2 zona pellucida glycoprotein 2
Expression
  • Assay Results
    12
Sequences
References
J:140807 Otsuka S, et al., Oocytes in newborn MRL mouse testes. Biol Reprod. 2008 Jul;79(1):9-16

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory