Dsh4A, Dsh4B Primer Detail MGI Mouse MGI:56

Dsh4A, Dsh4B Primer Detail

Name

Dsh4A, Dsh4B
Primer 1 Sequence

AAGTTCATGGGCCTCACCACCTGTC
Primer 2 Sequence

TACTAGCTACCCTTCACATACC
ID

MGI:56
Product Size

100-300bp

Dvl1

dishevelled segment polarity protein 1

J:2643 Beier DR, et al., Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6

Notes: Radioisotopically labeled PCR products were electrophoresed on a 5% nondenaturing polyacrylamide gel and subsequently analyzed using autoradiography.

Gene	Allele	Fragments	Strains
Dvl1	a	multiple	AKR/J, C3H/HeJ, DBA/2J
	b	multiple	C57BL/6J, C57L/J
	s	multiple	M. spretus

J:4594 Eicher EM, et al., Mamm Genome. 1993;4(4):226-9

Endonuclease	Gene	Allele	Fragments	Strains
	Dvl1	b	smaller	C57BL/6J
	Dvl1	s	larger	M. spretus

J:2643 Beier DR, et al., Mapping genes in the mouse using single-strand conformation polymorphism analysis of recombinant inbred strains and interspecific crosses. Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6

J:4594 Eicher EM, et al., Molecular markers that define the distal ends of mouse autosomes 4, 13, and 19 and the sex chromosomes. Mamm Genome. 1993;4(4):226-9

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23