About   Help   FAQ
mAP51-5', mAP51-3' Primer Detail
Primers
  • Name
    mAP51-5', mAP51-3'
  • Primer 1 Sequence
    AGGGCATCTCGAAACGCATCCA
  • Primer 2 Sequence
    CTTCTAGTTCTTCCAGGTCTTTTT
  • ID
    MGI:5496635
Genes
Rmdn3 regulator of microtubule dynamics 3
Expression
  • Assay Results
    4
References
J:133715 Maerker D, et al., Expression of PTPIP51 during mouse eye development. Histochem Cell Biol. 2008 Mar;129(3):345-56

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
01/31/2023
MGI 6.22
The Jackson Laboratory