About   Help   FAQ
TJ-2.133 Primer Detail
Primers
  • Name
    TJ-2.133
  • Primer 1 Sequence
    ATTGGTGATCTTACAGAATAC
  • Primer 2 Sequence
    GTGGTCATGATATTCGTAGAT
  • ID
    MGI:537
  • Product Size
    90bp
  • Synonyms
    T37
Genes
D16Nds2 DNA segment, Chr 16, Nuffield Department of Surgery 2
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D16Nds2 d largest DBA/2J
h larger B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7
n smaller AKR/J, NOD, NON
s smallest M. spretus
J:11584 Irving NG, et al., Genomics. 1991 Nov;11(3):679-86
Notes: Using the TJ-2.133 primer pair, genomic DNAs from the indicated strains were amplified via PCR, run on a 4% agarose gel and stained with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
D16Nds2 b 100bp C57BL/6, C57BL/10
s 85,110bp M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D16Nds2 a 90bp A/J, BALB/cJ
d 103bp C3H/HeJ, DBA/2J
e 98bp B6.Cg-Lepob/+, C57BL/6J
f 88bp AKR/J, CAST/EiJ, NOD/MrkTac, NON/ShiLt
J:16441 Yamada Y, et al., Cancer Res. 1994 Jan 15;54(2):403-7
Notes: PCR products were resolved by electrophoresis on a 4% ararose gel and visualized by ethidium bromide.
Endonuclease Gene Allele Fragments Strains
D16Nds2 n 98bp NFS/N
s 103bp SL/KhStmRbrc
J:30502 Slingsby JH, et al., Immunogenetics. 1996;43(1-2):72-5
Endonuclease Gene Allele Fragments Strains
D16Nds2 b not given C57BL/6By, C57BL/6ByJ, C57BL/6Ei, C57BL/6J, C57BLKS/J
s not given C57BL/10J, C57BL/10Nimr, C57BL/10ScSnJ, C57BL/10SnJ
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:11584 Irving NG, et al., Mouse chromosome-specific markers generated by PCR and their mapping through interspecific backcrosses. Genomics. 1991 Nov;11(3):679-86
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:16441 Yamada Y, et al., Genetic predisposition to pre-B lymphomas in SL/Kh strain mice. Cancer Res. 1994 Jan 15;54(2):403-7
J:30502 Slingsby JH, et al., New microsatellite polymorphisms identified between C57BL/6, C57BL/10, and C57BL/KsJ inbred mouse strains. Immunogenetics. 1996;43(1-2):72-5
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory