TJ-2.133 Primer Detail MGI Mouse MGI:537

TJ-2.133 Primer Detail

Name

TJ-2.133
Primer 1 Sequence

ATTGGTGATCTTACAGAATAC
Primer 2 Sequence

GTGGTCATGATATTCGTAGAT
ID

MGI:537
Product Size

90bp
Synonyms

T37

D16Nds2

DNA segment, Chr 16, Nuffield Department of Surgery 2

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D16Nds2	d	largest	DBA/2J
	h	larger	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7
	n	smaller	AKR/J, NOD, NON
	s	smallest	M. spretus

J:11584 Irving NG, et al., Genomics. 1991 Nov;11(3):679-86

Notes: Using the TJ-2.133 primer pair, genomic DNAs from the indicated strains were amplified via PCR, run on a 4% agarose gel and stained with ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
	D16Nds2	b	100bp	C57BL/6, C57BL/10
	D16Nds2	s	85,110bp	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D16Nds2	a	90bp	A/J, BALB/cJ
	d	103bp	C3H/HeJ, DBA/2J
	e	98bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	88bp	AKR/J, CAST/EiJ, NOD/MrkTac, NON/ShiLt

J:16441 Yamada Y, et al., Cancer Res. 1994 Jan 15;54(2):403-7

Notes: PCR products were resolved by electrophoresis on a 4% ararose gel and visualized by ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
	D16Nds2	n	98bp	NFS/N
	D16Nds2	s	103bp	SL/KhStmRbrc

J:30502 Slingsby JH, et al., Immunogenetics. 1996;43(1-2):72-5

Endonuclease	Gene	Allele	Fragments	Strains
	D16Nds2	b	not given	C57BL/6By, C57BL/6ByJ, C57BL/6Ei, C57BL/6J, C57BLKS/J
	D16Nds2	s	not given	C57BL/10J, C57BL/10Nimr, C57BL/10ScSnJ, C57BL/10SnJ

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:11584 Irving NG, et al., Mouse chromosome-specific markers generated by PCR and their mapping through interspecific backcrosses. Genomics. 1991 Nov;11(3):679-86

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:16441 Yamada Y, et al., Genetic predisposition to pre-B lymphomas in SL/Kh strain mice. Cancer Res. 1994 Jan 15;54(2):403-7

J:30502 Slingsby JH, et al., New microsatellite polymorphisms identified between C57BL/6, C57BL/10, and C57BL/KsJ inbred mouse strains. Immunogenetics. 1996;43(1-2):72-5

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24