About   Help   FAQ
L1 repeat element Primer Detail
Primers
  • Name
    L1 repeat element
  • Primer 1 Sequence
    GGTATGGGGGACTTTTGGGAT
  • Primer 2 Sequence
    GGTATGGGGGACTTTTGGGAT
  • ID
    MGI:536
Genes
D16Smh250 DNA segment, Chr 16, St. Mary's Hospital 250
D16Smh580 DNA segment, Chr 16, St. Mary's Hospital 580
Polymorphisms
J:11584 Irving NG, et al., Genomics. 1991 Nov;11(3):679-86
Notes: Using the L1 repeat element as a primer source, genomic DNAs from the indicated strains were amplified via PCR, run on a 3% agarose gel and stained with ethidium bromide. Using the L1 repeat element as a primer source, genomic DNAs from the indicated strains were amplified via PCR, run on a 3% agarose gel and subjected to Southern analysis.
Endonuclease Gene Allele Fragments Strains
D16Smh250 b 250,180bp C57BL/6, C57BL/10
s 240,180bp M. spretus
D16Smh580 b 580,470bp C57BL/6
s absent M. spretus
References
J:11584 Irving NG, et al., Mouse chromosome-specific markers generated by PCR and their mapping through interspecific backcrosses. Genomics. 1991 Nov;11(3):679-86
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory