About   Help   FAQ
Tpcn2-pA, Tpcn2-pB Primer Detail
Primers
  • Name
    Tpcn2-pA, Tpcn2-pB
  • Primer 1 Sequence
    GGCTGTGGTACCGCCACCATGGCGGCAGAAGAGCAGC
  • Primer 2 Sequence
    GCCGCTCGAGAGGCCAGCATCTCTGTCCTG
  • ID
    MGI:5293665
  • Region Covered
    complete open-reading frame
  • Product Size
    2.255 kb
  • Note
    Primer 1 sequence binds to the 5' end and contains a Kozak consensus sequence and a Kpn I restriction site for cloning. Primer 2 sequence binds to the 3' untranslated region and contains a Xho I restriction site for cloning.
Genes
Tpcn2 two pore segment channel 2
References
J:175352 Zong X, et al., The two-pore channel TPCN2 mediates NAADP-dependent Ca(2+)-release from lysosomal stores. Pflugers Arch. 2009 Sep;458(5):891-9
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
03/25/2025
MGI 6.24 		The Jackson Laboratory