About   Help   FAQ
DB41, DB42 Primer Detail
Primers
  • Name
    DB41, DB42
  • Primer 1 Sequence
    GACTAGGCTGCAACAGCTTCC
  • Primer 2 Sequence
    CTCCTTGGCTGTTATCTTCGG
  • ID
    MGI:51
  • Product Size
    100-300bp
Genes
Nppa natriuretic peptide type A
Polymorphisms
J:2643 Beier DR, et al., Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6
Notes: Radioisotopically labeled PCR products were electrophoresed on a 5% nondenaturing polyacrylamide gel and subsequently analyzed using autoradiography.
Endonuclease Gene Allele Fragments Strains
Nppa a multiple AKR/J, C3H/HeJ, C57L/J, DBA/2J
b multiple C57BL/6J
s multiple M. spretus
J:4594 Eicher EM, et al., Mamm Genome. 1993;4(4):226-9
Endonuclease Gene Allele Fragments Strains
Nppa b smaller C57BL/6J
s larger M. spretus
References
J:2643 Beier DR, et al., Mapping genes in the mouse using single-strand conformation polymorphism analysis of recombinant inbred strains and interspecific crosses. Proc Natl Acad Sci U S A. 1992 Oct 1;89(19):9102-6
J:4594 Eicher EM, et al., Molecular markers that define the distal ends of mouse autosomes 4, 13, and 19 and the sex chromosomes. Mamm Genome. 1993;4(4):226-9
J:24376 Beier DR, et al., Haplotype analysis of intra-specific backcross curly-tail mice confirms the localization of ct to chromosome 4. Mamm Genome. 1995 Apr;6(4):269-72

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory