About   Help   FAQ
Il6-pC, Il6-pD Primer Detail
Primers
  • Name
    Il6-pC, Il6-pD
  • Primer 1 Sequence
    TGTATAGAGCCCAATAAAGTG
  • Primer 2 Sequence
    ACCATGCCCAGCCTAATCTAG
  • ID
    MGI:508
  • Synonyms
    106.MMIL6A, 106MMIL6A
Genes
Il6 interleukin 6
Polymorphisms
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Il6 a largest PWK/Pas
b 2nd largest SEG/Pas
c 3rd largest 129S2/SvPas, BALB/cPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas
J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7
Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.
Endonuclease Gene Allele Fragments Strains
Il6 a 80bp AKR, BALB/c, C3H/He, C57BL/6J, CBA, DBA/1, DBA/2, MRL, MRL-Faslpr, NOD, NON, NZB, NZW, P/J, PL/J, SJL, SM/J, SWR
d 92bp M. m. domesticus
m 91bp M. m. musculus
s 93bp M. spretus
References
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory