Il6-pC, Il6-pD Primer Detail MGI Mouse MGI:508

Il6-pC, Il6-pD Primer Detail

Name

Il6-pC, Il6-pD
Primer 1 Sequence

TGTATAGAGCCCAATAAAGTG
Primer 2 Sequence

ACCATGCCCAGCCTAATCTAG
ID

MGI:508
Synonyms

106.MMIL6A, 106MMIL6A

Il6

interleukin 6

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Il6	a	largest	PWK/Pas
	b	2nd largest	SEG/Pas
	c	3rd largest	129S2/SvPas, BALB/cPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas

J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7

Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.

Gene	Allele	Fragments	Strains
Il6	a	80bp	AKR, BALB/c, C3H/He, C57BL/6J, CBA, DBA/1, DBA/2, MRL, MRL-Fas^lpr, NOD, NON, NZB, NZW, P/J, PL/J, SJL, SM/J, SWR
	d	92bp	M. m. domesticus
	m	91bp	M. m. musculus
	s	93bp	M. spretus

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23