About   Help   FAQ
Mirg-pE, Mirg-pF Primer Detail
Primers
  • Name
    Mirg-pE, Mirg-pF
  • Primer 1 Sequence
    TTGACTCCAGAAGATGCTCC
  • Primer 2 Sequence
    CCTCAGGTTCCTAAGCAAGG
  • ID
    MGI:5014182
  • Synonyms
    Mirg-RT_F, Mirg-RT_R
Genes
Mirg miRNA containing gene
Expression
  • Assay Results
    45
References
J:108133 Sekita Y, et al., Aberrant regulation of imprinted gene expression in Gtl2lacZ mice. Cytogenet Genome Res. 2006;113(1-4):223-9
J:147577 Takahashi N, et al., Deletion of Gtl2, imprinted non-coding RNA, with its differentially methylated region induces lethal parent-origin-dependent defects in mice. Hum Mol Genet. 2009 May 15;18(10):1879-88
J:266963 Saito T, et al., A tandem repeat array in IG-DMR is essential for imprinting of paternal allele at the Dlk1-Dio3 domain during embryonic development. Hum Mol Genet. 2018 Sep 15;27(18):3283-3292
J:299191 Kitazawa M, et al., Deficiency and overexpression of Rtl1 in the mouse cause distinct muscle abnormalities related to Temple and Kagami-Ogata syndromes. Development. 2020 Sep 2;147(21):dev185918

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory