About   Help   FAQ
RIKEN clone D030032G01 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone D030032G01 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:5001647
  • Region Covered
    nucleotides 27 - 726 of AK050903.1
  • Parent Clone
  • Insert Size
    0.699kb
  • Note
    This probe was generated via PCR using the following primer set: TGTTCATGGCCCAGACTGGC and TAATACGACTCACTATAGGGAGGGACAGTCACATCAAC. These primers were designed to the coding region. A T7 promoter sequence was added to the reverse primer for probe transcription.
  • Synonyms
    GUDMAP:11643 probe, GUDMAP:11644 probe, maprobe:5616
Source
  • Library
    Riken mouse cDNA library D0-300 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    embryonic day 9.0
  • Tissue
    body
Genes
Ahnak AHNAK nucleoprotein
Expression
  • Assay Results
    24
Sequences
AK050903 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory