About   Help   FAQ
RIKEN clone D630023J05 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone D630023J05 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:5001285
  • Region Covered
    3' untranslated region of gene (nucleotides 1540 - 2107 of AK052687.1)
  • Parent Clone
  • Insert Size
    0.567kb
  • Note
    This probe was generated via PCR using the following primer set: CAGAAAAGCAGATGCATATCTTAAA and CGATGTTAATACGACTCACTATAGGGGCCCGATTTCAAACTTCAGA. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
  • Synonyms
    GUDMAP:13554 probe, GUDMAP:13555 probe, maprobe:6027
Source
  • Library
    Riken mouse cDNA library D6-300 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal day 0
  • Tissue
    kidney
Genes
Epb41l5 erythrocyte membrane protein band 4.1 like 5
Expression
  • Assay Results
    13
Sequences
AK052687 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
05/30/2023
MGI 6.22
The Jackson Laboratory