RIKEN clone 6720477C19 subclone Probe Detail MGI Mouse MGI:5001092

RIKEN clone 6720477C19 subclone Probe Detail

Name

RIKEN clone 6720477C19 subclone
Sequence Type

cDNA
ID

MGI:5001092
Region Covered

3' untranslated region of gene (nucleotides 110 - 732 of AK020162.1)
Parent Clone

RIKEN clone 6720477C19
Insert Size

0.622kb
Note

This probe was generated via PCR using the following primer set: CTGAACTCAGCCTCCAGGTC and CGATGTTAATACGACTCACTATAGGGCACCATTTCCAAAACTGCCT. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
Synonyms

GUDMAP:11762 probe, GUDMAP:11763 probe, GUDMAP:11764 probe, maprobe:5650

RIKEN cDNA 6720477C19 gene

AK020162 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)

J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23