RIKEN clone 5230400M03 subclone Probe Detail MGI Mouse MGI:5001025

RIKEN clone 5230400M03 subclone Probe Detail

Name

RIKEN clone 5230400M03 subclone
Sequence Type

cDNA
ID

MGI:5001025
Region Covered

3' untranslated region of gene (nucleotides 1254 - 1851 of AK030345.1)
Parent Clone

RIKEN clone 5230400M03
Insert Size

0.597kb
Note

This probe was generated via PCR using the following primer set: CTTAGCCTTTCGCCTGTGTC and CGATGTTAATACGACTCACTATAGGGAGCCGGCTGAGACTATGAAA. The reverse primer is linked to a T7 Polymerase promoter tag sequence.
Synonyms

GUDMAP:11756 probe, GUDMAP:11757 probe, GUDMAP:11758 probe, maprobe:5648

RIKEN cDNA 5230400M03 gene

AK030345 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)

J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13