About   Help   FAQ
T56106-pA, T56106-pB Primer Detail
Primers
  • Name
    T56106-pA, T56106-pB
  • Primer 1 Sequence
    TCCAGAGTTTCCTGGGAATG
  • Primer 2 Sequence
    GTACAGCGTGGACGGAATCT
  • ID
    MGI:4938276
  • Note
    The specificity of this primer set is unclear; the gene symbol provided by the authors does not correspond with that obtained from sequence analysis using the provided probe sequence.
  • Synonyms
    MH3223-pA, MH3223-pB
Genes
Pttg1ip pituitary tumor-transforming 1 interacting protein
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory