About   Help   FAQ
g00409 Probe Detail
Nucleotide
Probe/Clone
  • Name
    g00409
  • Sequence Type
    cDNA
  • ID
    MGI:4884353
  • Note
    Probe sequence provided by the Brain Gene Expression Map (BGEM) database:
    CCCTCGGGCACAGCATCACGCCAGCCACAGACACAACAGCAGCAACAGCAGCAGCAGCAA
    CAGCAGGGTCTTGGGCAACAAGCCCCCCAGCAGGCTCCATCCCAGGCTCGGCTACAGCCT
    CAGAGCCAGCCAACCACCCGGGGCACAGCCCCTGCTGCCAGCCAACCAGCGGGGAAACCT
    CAGCCAGGCCCCACCACAGCCCCAGGGCCCCAGCCAGCAGGACCGCCACGTGCAGAGCAG
    GCCAGCAGCTCTAAACCACCCGCAGCCAAAGCGCCCCAGCAGGGACGGGCTCCTCAGGCG
    CAGACAACTCCAGGACCTGGACCTGCAGGGGCGAAGCCTGGAGCCAGGCCTGGAGGGACC
    CCAGGGGCTCCCGCTGGTCAGCCAGGGGCAGAAGGAGAGAGTGTATTCTCTAAGATCCTC
    CCTGGTGGGGCAGCAGAACAAGCTGGAAAGCTGACAGAAGCTGTCTCTGCTTTTGGCAAA
    AAATTTTCCTCATTCTGGTG
Source
  • Species
    mouse, laboratory
  • Age
    postnatal day 0
Genes
Bsn bassoon
Expression
  • Assay Results
    25
References
J:162220 Magdaleno S, et al., BGEM: an in situ hybridization database of gene expression in the embryonic and adult mouse nervous system. PLoS Biol. 2006 Apr;4(4):e86

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory