About   Help   FAQ
RIKEN clone 6330569O10 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone 6330569O10 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:4846079
  • Region Covered
    Probe sequence spans from 207 to 734 of AK032067.1
  • Parent Clone
  • Insert Size
    .527kb
  • Note
    This probe was generated by PCR using the following primer set: CAACATGCGTGTTATCCAGG and CGATGTTAATACGACTCACTATAGGGACAAATGGTTCCCGTAGCTG. The reverse primer is linked to a T7 polymerase promoter tag.
  • Synonyms
    GUDMAP:7439 probe, GUDMAP:7440 probe, GUDMAP:7441 probe, GUDMAP:7442 probe, GUDMAP:7759 probe, GUDMAP:7760 probe, GUDMAP:7761 probe, GUDMAP:7762 probe, GUDMAP:7928 probe, GUDMAP:8211 probe, GUDMAP:8833 probe, GUDMAP:8834 probe, GUDMAP:8835 probe, GUDMAP:8836 probe, GUDMAP:13969 probe, GUDMAP:14071 probe, GUDMAP:14072 probe, GUDMAP:14073 probe, GUDMAP:14074 probe, GUDMAP:14075 probe, maprobe:4261
Source
  • Library
    Riken mouse cDNA library 63-305 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal adult
  • Sex
    Male
  • Tissue
    medulla oblongata
Genes
Lhx1 LIM homeobox protein 1
Expression
  • Assay Results
    320
Sequences
AK032067 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:148410 Combes AN, et al., Three-dimensional visualization of testis cord morphogenesis, a novel tubulogenic mechanism in development. Dev Dyn. 2009 May;238(5):1033-41
J:171050 Thiagarajan RD, et al., Identification of anchor genes during kidney development defines ontological relationships, molecular subcompartments and regulatory pathways. PLoS One. 2011;6(2):e17286
J:171615 Georgas KM, et al., Expression of metanephric nephron-patterning genes in differentiating mesonephric tubules. Dev Dyn. 2011 Jun;240(6):1600-12

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory