About   Help   FAQ
RIKEN clone 2010015B04 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone 2010015B04 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:4845976
  • Region Covered
    Probe sequence spans from 219 to 1088 of AK008244.1
  • Parent Clone
  • Insert Size
    .869kb
  • Note
    This probe was generated by PCR using the following primer set: TTTCAAGAAGTCCCACCCAC and CGATGTTAATACGACTCACTATAGGGCTGAAGCCGCTTGACATACA. The reverse primer is linked to a T7 polymerase promoter tag.
  • Synonyms
    GUDMAP:9034 probe, GUDMAP:9035 probe, GUDMAP:9477 probe, GUDMAP:9478 probe, GUDMAP:9479 probe, GUDMAP:9480 probe, GUDMAP:9481 probe, GUDMAP:10927 probe, GUDMAP:10928 probe, maprobe:4735
Source
  • Library
    Riken mouse cDNA library 20-100 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    postnatal adult
  • Sex
    Male
  • Tissue
    small intestine
Genes
Aadac arylacetamide deacetylase
Expression
  • Assay Results
    148
Sequences
AK008244 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:148410 Combes AN, et al., Three-dimensional visualization of testis cord morphogenesis, a novel tubulogenic mechanism in development. Dev Dyn. 2009 May;238(5):1033-41

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory