About   Help   FAQ
RIKEN clone 9430031G15 subclone Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone 9430031G15 subclone
  • Sequence Type
    cDNA
  • ID
    MGI:4845917
  • Region Covered
    Probe sequence spans from 18 to 517 of AK020449.1
  • Parent Clone
  • Insert Size
    .499kb
  • Note
    This probe was generated by PCR using the following primer set: CAGTGGAAAAGAGGCAGGAC and CGATGTTAATACGACTCACTATAGGGCAATGGTAAATGTTTGGGGG. The reverse primer is linked to a T7 polymerase promoter tag.
  • Synonyms
    GUDMAP:7447 probe, GUDMAP:7448 probe, GUDMAP:7449 probe, GUDMAP:7450 probe, GUDMAP:7755 probe, GUDMAP:7756 probe, GUDMAP:7757 probe, GUDMAP:7758 probe, GUDMAP:7813 probe, GUDMAP:7851 probe, GUDMAP:8889 probe, GUDMAP:8890 probe, GUDMAP:9074 probe, GUDMAP:9075 probe, GUDMAP:9076 probe, GUDMAP:9077 probe, GUDMAP:9078 probe, GUDMAP:13634 probe, maprobe:4263
Source
  • Library
    Riken mouse cDNA library 94-300 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    embryonic day 12.0
  • Tissue
    embryonic body between diaphragm region and neck
Genes
Ltbp1 latent transforming growth factor beta binding protein 1
Expression
  • Assay Results
    211
Sequences
AK020449 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:148410 Combes AN, et al., Three-dimensional visualization of testis cord morphogenesis, a novel tubulogenic mechanism in development. Dev Dyn. 2009 May;238(5):1033-41
J:171615 Georgas KM, et al., Expression of metanephric nephron-patterning genes in differentiating mesonephric tubules. Dev Dyn. 2011 Jun;240(6):1600-12

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory