About   Help   FAQ
RIKEN clone 2810012H16 subclone 2 Probe Detail
Nucleotide
Probe/Clone
  • Name
    RIKEN clone 2810012H16 subclone 2
  • Sequence Type
    cDNA
  • ID
    MGI:4838226
  • Region Covered
    nucleotides 653 - 1351 of AK012727.1
  • Parent Clone
  • Note
    This probe was generated by PCR using the following primer set: GCGTAGCCTTCTCACAGTCC and CGATGTTAATACGACTCACTATAGGGCTTGAGGACCCAAAAACCAA. The reverse primer is linked to a T7 polymerase promoter tag.
  • Synonyms
    GUDMAP:7155 probe, GUDMAP:7156 probe, GUDMAP:7157 probe, GUDMAP:7158 probe, GUDMAP:7159 probe, GUDMAP:7160 probe, GUDMAP:7466 probe, GUDMAP:8208 probe, GUDMAP:8209 probe, GUDMAP:13629 probe, GUDMAP:13784 probe, GUDMAP:13785 probe, GUDMAP:14081 probe, GUDMAP:14082 probe, GUDMAP:14083 probe, GUDMAP:14084 probe, GUDMAP:14182 probe, maprobe:4223
Source
  • Library
    Riken mouse cDNA library 28-100 (J:80000)
  • Species
    mouse, laboratory
  • Strain
    C57BL/6J
  • Age
    embryonic day 10.5,11.0
  • Tissue
    body
  • Tissue Description
    pooled days 10.0,11.0
Genes
Wnt4 wingless-type MMTV integration site family, member 4
Expression
  • Assay Results
    341
Sequences
AK012727 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:138858 Georgas K, et al., Use of dual section mRNA in situ hybridisation/immunohistochemistry to clarify gene expression patterns during the early stages of nephron development in the embryo and in the mature nephron of the adult mouse kidney. Histochem Cell Biol. 2008 Nov;130(5):927-42
J:148410 Combes AN, et al., Three-dimensional visualization of testis cord morphogenesis, a novel tubulogenic mechanism in development. Dev Dyn. 2009 May;238(5):1033-41
J:171050 Thiagarajan RD, et al., Identification of anchor genes during kidney development defines ontological relationships, molecular subcompartments and regulatory pathways. PLoS One. 2011;6(2):e17286
J:171615 Georgas KM, et al., Expression of metanephric nephron-patterning genes in differentiating mesonephric tubules. Dev Dyn. 2011 Jun;240(6):1600-12

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory