About   Help   FAQ
Gli1-pI, Gli1-pJ Primer Detail
Primers
  • Name
    Gli1-pI, Gli1-pJ
  • Primer 1 Sequence
    CCAAGCCAACTTTATGTCAGGG
  • Primer 2 Sequence
    AGCCCGCTTCTTTGTTAATTTGA
  • ID
    MGI:4415334
Genes
Gli1 GLI-Kruppel family member GLI1
Expression
  • Assay Results
    21
References
J:154891 Hirose Y, et al., Hedgehog signal activation coordinates proliferation and differentiation of fetal liver progenitor cells. Exp Cell Res. 2009 Sep 10;315(15):2648-57
J:225747 Jayewickreme CD, et al., Control of stomach smooth muscle development and intestinal rotation by transcription factor BARX1. Dev Biol. 2015 Sep 1;405(1):21-32
J:240101 Lv J, et al., 5-hydroxytryptamine synthesized in the aorta-gonad-mesonephros regulates hematopoietic stem and progenitor cell survival. J Exp Med. 2017 Feb;214(2):529-545
J:267540 Cesario JM, et al., Anti-osteogenic function of a LIM-homeodomain transcription factor LMX1B is essential to early patterning of the calvaria. Dev Biol. 2018 Nov 15;443(2):103-116
J:270082 Kim SE, et al., Dominant negative GPR161 rare variants are risk factors of human spina bifida. Hum Mol Genet. 2019 Jan 15;28(2):200-208
J:345410 Wang Y, et al., TMEM216 promotes primary ciliogenesis and Hedgehog signaling through the SUFU-GLI2/GLI3 axis. Sci Signal. 2024 Jan 23;17(820):eabo0465

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory