GT9 Primer Detail MGI Mouse MGI:40

GT9 Primer Detail

Name

GT9
Primer 1 Sequence

TAAGAACCTTCTGTAGTTATT
Primer 2 Sequence

ACCTTAGTTAGAGTTGGTCTC
ID

MGI:40
Product Size

100bp
Synonyms

T33

D11Nds1

DNA segment, Chr 11, Nuffield Department of Surgery 1

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D11Nds1	h	smaller	B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7
	n	larger	AKR/J, DBA/2J, NOD, NON
	s	smallest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D11Nds1	d	108bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	e	102bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J
	f	132bp	CAST/EiJ
	s	100bp	SPRET/EiJ

J:4562 Byrd LG, Immunogenetics. 1993;37(2):157-9

Notes: Only diagnostic band was given for the CLA strain.

Gene	Allele	Fragments	Strains
D11Nds1	b	100bp	BALB/cAnPt
	c	110bp	CLA
	n	95bp	BALB/c-Foxn1^nu

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D11Nds1	a	smaller	AKR/J
	b	smallest	C57BL/J
	l	largest	LG/J
	s	larger	SM/J

J:28719 Lord CJ, et al., Mamm Genome. 1995 Sep;6(9):563-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Nds1	b	102bp	B6.PL-Thy1^a/CyJ
Not Specified	D11Nds1	n	107bp	NOD/MrkTac

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:4562 Byrd LG, Regional localization of the nu mutation on mouse chromosome 11. Immunogenetics. 1993;37(2):157-9

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:28719 Lord CJ, et al., Mapping the diabetes polygene Idd3 on mouse chromosome 3 by use of novel congenic strains. Mamm Genome. 1995 Sep;6(9):563-70

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24