About   Help   FAQ
GT9 Primer Detail
Primers
  • Name
    GT9
  • Primer 1 Sequence
    TAAGAACCTTCTGTAGTTATT
  • Primer 2 Sequence
    ACCTTAGTTAGAGTTGGTCTC
  • ID
    MGI:40
  • Product Size
    100bp
  • Synonyms
    T33
Genes
D11Nds1 DNA segment, Chr 11, Nuffield Department of Surgery 1
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D11Nds1 h smaller B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7
n larger AKR/J, DBA/2J, NOD, NON
s smallest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D11Nds1 d 108bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
e 102bp A/J, B6.Cg-Lepob/+, C57BL/6J
f 132bp CAST/EiJ
s 100bp SPRET/EiJ
J:4562 Byrd LG, Immunogenetics. 1993;37(2):157-9
Notes: Only diagnostic band was given for the CLA strain.
Endonuclease Gene Allele Fragments Strains
D11Nds1 b 100bp BALB/cAnPt
c 110bp CLA
n 95bp BALB/c-Foxn1nu
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D11Nds1 a smaller AKR/J
b smallest C57BL/J
l largest LG/J
s larger SM/J
J:28719 Lord CJ, et al., Mamm Genome. 1995 Sep;6(9):563-70
Endonuclease Gene Allele Fragments Strains
Not Specified D11Nds1 b 102bp B6.PL-Thy1a/CyJ
n 107bp NOD/MrkTac
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:4562 Byrd LG, Regional localization of the nu mutation on mouse chromosome 11. Immunogenetics. 1993;37(2):157-9
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:28719 Lord CJ, et al., Mapping the diabetes polygene Idd3 on mouse chromosome 3 by use of novel congenic strains. Mamm Genome. 1995 Sep;6(9):563-70
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory