About   Help   FAQ
Zp2-pE, Zp2-pF Primer Detail
Primers
  • Name
    Zp2-pE, Zp2-pF
  • Primer 1 Sequence
    ACTGCACTTATGCTCTGGACT
  • Primer 2 Sequence
    GGTGTCCCCCACTCTGATG
  • ID
    MGI:3839393
Genes
Zp2 zona pellucida glycoprotein 2
Expression
  • Assay Results
    2
References
J:143535 Toyoda S, et al., Sohlh2 affects differentiation of KIT positive oocytes and spermatogonia. Dev Biol. 2009 Jan 1;325(1):238-48

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory