About   Help   FAQ
T9 Primer Detail
Primers
  • Name
    T9
  • Primer 1 Sequence
    GTAATTGCGTTGACTGTTAAAT
  • Primer 2 Sequence
    AGTGCTGCTCCCAACATTACT
  • ID
    MGI:379
Genes
D17Nds2 DNA segment, Chr 17, Nuffield Department of Surgery 2
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D17Nds2 e 110bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
f 105bp A/J, AKR/J, BALB/cJ, CAST/EiJ, DBA/2J
j 125bp NOD/MrkTac
s 80bp SPRET/EiJ
J:17312 Cheah YC, et al., Mamm Genome. 1994 Mar;5(3):189-90
Endonuclease Gene Allele Fragments Strains
D17Nds2 a smaller AKR/J
l larger C57L/J
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:17312 Cheah YC, et al., Strain distribution patterns for 50 SSLP markers in the murine AKXL recombinant inbred set. Mamm Genome. 1994 Mar;5(3):189-90
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory