About   Help   FAQ
FG49-pA, FG49-pB Primer Detail
Primers
  • Name
    FG49-pA, FG49-pB
  • Primer 1 Sequence
    GGAGACGATTGCCATCAAGGAC
  • Primer 2 Sequence
    ATGGGACAGAGACAAGCTCC
  • ID
    MGI:3766253
Genes
Fgf15 fibroblast growth factor 15
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:101025 Yaylaoglu MB, et al., Comprehensive expression atlas of fibroblast growth factors and their receptors generated by a novel robotic in situ hybridization platform. Dev Dyn. 2005 Oct;234(2):371-86
J:127119 Visel A, et al., Regulatory pathway analysis by high-throughput in situ hybridization. PLoS Genet. 2007 Oct 19;3(10):1867-83

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory