About   Help   FAQ
MH727-pA, MH727-pB Primer Detail
Primers
  • Name
    MH727-pA, MH727-pB
  • Primer 1 Sequence
    TCTGAGAGCTCTGCAAACGA
  • Primer 2 Sequence
    AGCTGCAGTTGCAAATTCCT
  • ID
    MGI:3723865
  • Synonyms
    Cdca7-pF1, Cdca7-pR1
Genes
Cdca7 cell division cycle associated 7
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:197897 Mi D, et al., Pax6 exerts regional control of cortical progenitor proliferation via direct repression of Cdk6 and hypophosphorylation of pRb. Neuron. 2013 Apr 24;78(2):269-84
J:311233 Huang YT, et al., Lateral cortical Cdca7 expression levels are regulated by Pax6 and influence the production of intermediate progenitors. BMC Neurosci. 2017 Jun 5;18(1):47

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory