About   Help   FAQ
MH511-pA, MH511-pB Primer Detail
Primers
  • Name
    MH511-pA, MH511-pB
  • Primer 1 Sequence
    AGGATCTTTGGGGAGAAGG
  • Primer 2 Sequence
    TCGAGGTTTCTTCAGCTGGT
  • ID
    MGI:3723732
  • Synonyms
    T50263-pA, T50263-pB
Genes
Cux1 cut-like homeobox 1
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:149737 Sansom SN, et al., The level of the transcription factor Pax6 is essential for controlling the balance between neural stem cell self-renewal and neurogenesis. PLoS Genet. 2009 Jun;5(6):e1000511
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory