About   Help   FAQ
MH359-pA, MH359-pB Primer Detail
Primers
  • Name
    MH359-pA, MH359-pB
  • Primer 1 Sequence
    GCTGTTGCTGCTTCTTGTTGC
  • Primer 2 Sequence
    GGGAGGAAGTGAGCAGAGGTG
  • ID
    MGI:3723669
  • Synonyms
    FG47-pA, FG47-pB, T50396-pA, T50396-pB
Genes
Fgf10 fibroblast growth factor 10
References
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:101025 Yaylaoglu MB, et al., Comprehensive expression atlas of fibroblast growth factors and their receptors generated by a novel robotic in situ hybridization platform. Dev Dyn. 2005 Oct;234(2):371-86
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory