About   Help   FAQ
Sox9-pG, Sox9-pH Primer Detail
Primers
  • Name
    Sox9-pG, Sox9-pH
  • Primer 1 Sequence
    AGTACCCGCATCTGCACAAC
  • Primer 2 Sequence
    TACTTGTAATCGGGGTGGTCT
  • ID
    MGI:3706532
  • Synonyms
    AQ- Sox9-F, AQ- Sox9-R
Genes
Sox9 SRY (sex determining region Y)-box 9
Expression
  • Assay Results
    111
References
J:120357 Svingen T, et al., Aard is specifically up-regulated in Sertoli cells during mouse testis differentiation. Int J Dev Biol. 2007;51:255-258
J:122361 Svingen T, et al., Sex-specific expression of a novel gene Tmem184a during mouse testis differentiation. Reproduction. 2007 May;133(5):983-9
J:142977 Polanco JC, et al., Functional analysis of the SRY-KRAB interaction in mouse sex determination. Biol Cell. 2009 Jan;101(1):55-67
J:150223 Beverdam A, et al., Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice. Reproduction. 2009 Mar;137(3):481-6
J:164222 Beverdam A, et al., Protein tyrosine kinase 2 beta (PTK2B), but not focal adhesion kinase (FAK), is expressed in a sexually dimorphic pattern in developing mouse gonads. Dev Dyn. 2010 Oct;239(10):2735-41
J:211539 Chen Y, et al., Compensatory regulation of the Snai1 and Snai2 genes during chondrogenesis. J Bone Miner Res. 2013 Jun;28(6):1412-21
J:216502 Wainwright EN, et al., Primary cilia function regulates the length of the embryonic trunk axis and urogenital field in mice. Dev Biol. 2014 Nov 15;395(2):342-54
J:220472 Zhao L, et al., Female-to-male sex reversal in mice caused by transgenic overexpression of Dmrt1. Development. 2015 Mar 15;142(6):1083-8
J:237573 Ortega EA, et al., Sry-Independent Overexpression of Sox9 Supports Spermatogenesis and Fertility in the Mouse. Biol Reprod. 2015 Dec;93(6):141
J:238708 Gonen N, et al., Normal Levels of Sox9 Expression in the Developing Mouse Testis Depend on the TES/TESCO Enhancer, but This Does Not Act Alone. PLoS Genet. 2017 Jan;13(1):e1006520
J:240405 Zhao L, et al., SOX4 regulates gonad morphogenesis and promotes male germ cell differentiation in mice. Dev Biol. 2017 Mar 01;423(1):46-56
J:247327 Spiller CM, et al., Mice Lacking Hbp1 Function Are Viable and Fertile. PLoS One. 2017;12(1):e0170576
J:278064 Tsuji-Hosokawa A, et al., Peptidyl arginine deiminase 2 (Padi2) is expressed in Sertoli cells in a specific manner and regulated by SOX9 during testicular development. Sci Rep. 2018 Sep 5;8(1):13263
J:320934 Alankarage D, et al., Functional characterization of a novel PBX1 de novo missense variant identified in a patient with syndromic congenital heart disease. Hum Mol Genet. 2020 May 8;29(7):1068-1082

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory