About   Help   FAQ
Xbp1-pC, Xbp1-pD Primer Detail
Primers
  • Name
    Xbp1-pC, Xbp1-pD
  • Primer 1 Sequence
    GAACCAGGAGTTAAGAACACG
  • Primer 2 Sequence
    AGGCAACAGTGTCAGAGTCC
  • ID
    MGI:3655471
Genes
Xbp1 X-box binding protein 1
Expression
  • Assay Results
    17
References
J:87202 Iwawaki T, et al., A transgenic mouse model for monitoring endoplasmic reticulum stress. Nat Med. 2004 Jan;10(1):98-102
J:111577 Mao C, et al., In vivo regulation of Grp78/BiP transcription in the embryonic heart: role of the endoplasmic reticulum stress response element and GATA-4. J Biol Chem. 2006 Mar 31;281(13):8877-87
J:165678 Vellanki RN, et al., OASIS/CREB3L1 induces expression of genes involved in extracellular matrix production but not classical endoplasmic reticulum stress response genes in pancreatic beta-cells. Endocrinology. 2010 Sep;151(9):4146-57
J:168632 Firtina Z, et al., Unfolded Protein Response (UPR) is activated during normal lens development. Gene Expr Patterns. 2011 Jan-Feb;11(1-2):135-43
J:270211 Yang P, et al., Tip60- and sirtuin 2-regulated MARCKS acetylation and phosphorylation are required for diabetic embryopathy. Nat Commun. 2019 Jan 17;10(1):282

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory