About   Help   FAQ
SCC-pA, SCC-pB Primer Detail
Primers
  • Name
    SCC-pA, SCC-pB
  • Primer 1 Sequence
    GCACACAACTTGAAGGTACAGGAG
  • Primer 2 Sequence
    CAGCCAAAGCCCAAGTACCGGAAG
  • ID
    MGI:3604370
  • Synonyms
    Cyp11A-pA, Cyp11A-pB, P450scc sense; P450scc antisense, P450scc-pF, P450scc-pR
Genes
Cyp11a1 cytochrome P450, family 11, subfamily a, polypeptide 1
Expression
  • Assay Results
    8
References
J:27992 Keeney DS, et al., Cholesterol side-chain cleavage cytochrome P450 gene expression in the primitive gut of the mouse embryo does not require steroidogenic factor 1. Mol Endocrinol. 1995 Aug;9(8):1091-8
J:29760 Keeney DS, et al., Developmentally regulated expression of adrenal 17 alpha-hydroxylase cytochrome P450 in the mouse embryo. Endocrinology. 1995 Nov;136(11):4872-9
J:53330 Morohashi K, et al., Structural and functional abnormalities in the spleen of an mFtz-F1 gene-disrupted mouse. Blood. 1999 Mar 1;93(5):1586-94
J:62908 Venihaki M, et al., Circadian rise in maternal glucocorticoid prevents pulmonary dysplasia in fetal mice with adrenal insufficiency. Proc Natl Acad Sci U S A. 2000 Jun 20;97(13):7336-41

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory