About   Help   FAQ
Dmc1-pA, Dmc1-pB Primer Detail
Primers
  • Name
    Dmc1-pA, Dmc1-pB
  • Primer 1 Sequence
    TTCGTACTGGAAAAACTCAGCTGTATC
  • Primer 2 Sequence
    CTTGGCTGCGACATAATCAAGTAGCTCC
  • ID
    MGI:3583135
  • Synonyms
    L1, L2, PRI-Dmc15, PRI-Dmc13
Genes
Dmc1 DNA meiotic recombinase 1
Expression
  • Assay Results
    6
References
J:31333 Habu T, et al., The mouse and human homologs of DMC1, the yeast meiosis-specific homologous recombination gene, have a common unique form of exon-skipped transcript in meiosis. Nucleic Acids Res. 1996 Feb 1;24(3):470-7
J:61665 Tanaka SS, et al., The mouse homolog of Drosophila Vasa is required for the development of male germ cells. Genes Dev. 2000 Apr 1;14(7):841-53
J:91712 Ogi T, et al., Expression of human and mouse genes encoding polkappa: testis-specific developmental regulation and AhR-dependent inducible transcription. Genes Cells. 2001 Nov;6(11):943-53
J:95901 Li Q, et al., A targeted mutation of Nkd1 impairs mouse spermatogenesis. J Biol Chem. 2005 Jan 28;280(4):2831-9

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory