Sry-pE, Sry-pF Primer Detail MGI Mouse MGI:3510978

About Help FAQ

Sry-pE, Sry-pF Primer Detail

Name

Sry-pE, Sry-pF
Primer 1 Sequence

TTATGGTGTGGTCCCGTGGT
Primer 2 Sequence

GGCCTTTTTTCGGCTTCTGT
ID

MGI:3510978

Sry

sex determining region of Chr Y

Assay Results

56

J:93500 Bouma GJ, et al., Using real time RT-PCR analysis to determine multiple gene expression patterns during XX and XY mouse fetal gonad development. Gene Expr Patterns. 2004 Nov;5(1):141-9

J:183829 Correa SM, et al., Sex reversal in C57BL/6J XY mice caused by increased expression of ovarian genes and insufficient activation of the testis determining pathway. PLoS Genet. 2012 Apr;8(4):e1002569

J:237573 Ortega EA, et al., Sry-Independent Overexpression of Sox9 Supports Spermatogenesis and Fertility in the Mouse. Biol Reprod. 2015 Dec;93(6):141

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13