About   Help   FAQ
Adamts19-pC, Adamts19-pD Primer Detail
Primers
  • Name
    Adamts19-pC, Adamts19-pD
  • Primer 1 Sequence
    GGTCACAACATGGGCATCAAC
  • Primer 2 Sequence
    CTGGACCATGAAACATCACCAA
  • ID
    MGI:3510923
Genes
Adamts19 ADAM metallopeptidase with thrombospondin type 1 motif 19
Expression
  • Assay Results
    48
References
J:93500 Bouma GJ, et al., Using real time RT-PCR analysis to determine multiple gene expression patterns during XX and XY mouse fetal gonad development. Gene Expr Patterns. 2004 Nov;5(1):141-9
J:183829 Correa SM, et al., Sex reversal in C57BL/6J XY mice caused by increased expression of ovarian genes and insufficient activation of the testis determining pathway. PLoS Genet. 2012 Apr;8(4):e1002569

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/02/2024
MGI 6.13
The Jackson Laboratory