About   Help   FAQ
48.MMIL5G Primer Detail
Primers
  • Name
    48.MMIL5G
  • Primer 1 Sequence
    CCTTTCTGAAAGTATTAAGAGT
  • Primer 2 Sequence
    ACAACCATCTGCATATCCAGC
  • ID
    MGI:328
  • Product Size
    288bp
  • Synonyms
    48MMIL5G, Il5-pA, Il5-pB, MMIL5G
Genes
Il5 interleukin 5
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Il5 b largest B6.PL-Thy1a, C57BL/6J, DBA/2J
d smaller NON
n larger B10.H2nod, NOD
s smallest M. spretus
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Il5 a largest 129S2/SvPas, BALB/cPas, C3H/HePas, C57BL/6Pas, DBA/2Pas, DDK/Pas, STS/Pas
b 2nd largest PWK/Pas, SEG/Pas, SPE/Pas, SPR/Smh
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Il5 a largest A/JCrc
b larger AKR/Nimr, B10.D2-H2d/Nimr, BALB/cCrc, C3H/HeCrc, C57L/J, C58/OlaCrc, CBA/CaCrc, NOD/Crc
c smaller NZW/Ola
J:13182 Jacob CO, et al., Immunogenetics. 1993;38(4):251-7
Notes: Genomic DNA was amplified via PCR and then analyzed by electrophoresis on a 6% denaturing polyacrylamide gel.
Endonuclease Gene Allele Fragments Strains
Il5 a 206bp M. spretus
b 208bp M. m. musculus
c 210bp NZW
d 280bp M. m. domesticus
e 282bp SWR
f 286bp NOD
g 290bp NZB
h 302bp PL/J, SJL
i 288bp AKR, BALB/c, C3H/He, C57BL/6J, CBA, DBA/1, DBA/2, MRL, MRL-Faslpr, NON, P/J, SM/J
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:13182 Jacob CO, et al., DNA polymorphism in cytokine genes based on length variation in simple-sequence tandem repeats. Immunogenetics. 1993;38(4):251-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory