34.MMCYO3 Primer Detail MGI Mouse MGI:315

34.MMCYO3 Primer Detail

Name

34.MMCYO3
Primer 1 Sequence

AGTTTTAGGCTAGTATAGGTT
Primer 2 Sequence

ACTGGAACCTTAGAGCATGAG
ID

MGI:315
Product Size

198bp
Synonyms

34MMCYO3, MMCYO3

Cyp1a2

cytochrome P450, family 1, subfamily a, polypeptide 2

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Gene	Allele	Fragments	Strains
Cyp1a2	b	smaller	B6.PL-Thy1^a, B10.H2^nod, C57BL/6J, NON
	n	smallest	DBA/2J, NOD
	s	larger	M. spretus

J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.

Gene	Allele	Fragments	Strains
Cyp1a2	a	largest	SPR
	a'	largest	C3H/He
	b	2nd largest	B6.PL-Thy1^a, C57BL/6J, C57BL/10-H2^g7, NON
	b'	2nd largest	A
	c	3rd largest	DBA/2J, NOD
	c'	3rd largest	B10.BR-H2^k2 H2-T18^a/SgSnJ, BALB/cCrc, C58
	d'	4th largest	CBA/CaH-T(14;15)6Ca, DBA/2J, MEV/1TyJ, NOD/LtCrc

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Cyp1a2	a	largest	PWK/Pas
	b	2nd largest	C3H/HePas
	c	3rd largest	DDK/Pas
	d	4th largest	SEG/Pas, SPE/Pas, SPR/Smh
	e	5th largest	BALB/cPas, C57BL/6Pas
	f	6th largest	129S2/SvPas, DBA/2Pas, STS/Pas

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Cyp1a2	a	largest	C3H/HeCrc
	b	larger	A/JCrc
	c	smaller	AKR/Nimr, B10.D2-H2^d/Nimr, BALB/cCrc, C57L/J, C58/OlaCrc, NZW/Ola
	d	smallest	CBA/CaCrc, NOD/Crc

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23