About   Help   FAQ
24.MMBCL2 Primer Detail
Primers
  • Name
    24.MMBCL2
  • Primer 1 Sequence
    CATTATCAATGATGTACCATG
  • Primer 2 Sequence
    GCAGTAAATAGCTGATTCGAC
  • ID
    MGI:305
  • Product Size
    132bp
  • Synonyms
    24MMBCL2, MMBCL2
Genes
Bcl2 B cell leukemia/lymphoma 2
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Bcl2 b larger B6.PL-Thy1a, B10.H2nod, C57BL/6J, M. spretus
n smaller DBA/2J, NOD, NON
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Bcl2 a largest C57BL/6Pas, SPR/Smh
b 2nd largest 129S2/SvPas, BALB/cPas, C3H/HePas, DBA/2Pas, DDK/Pas, STS/Pas
c 3rd largest SEG/Pas, SPE/Pas
d 4th largest PWK/Pas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Bcl2 a largest B10.D2-H2d/Nimr, C58/OlaCrc
b larger C57L/J, NOD/Crc, NZW/Ola
c smaller AKR/Nimr, CBA/CaCrc
d smallest A/JCrc, BALB/cCrc, C3H/HeCrc
J:4265 Nonaka M, et al., Genomics. 1993 Mar;15(3):535-42
Notes: Genomic DNA was amplified via PCR, electrophoresed on a 20% polyacrylamide gel and viewed with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
Bcl2 h not given C3H/HeJ
s not given M. spretus
J:13559 Goulding M, et al., Genomics. 1993 Aug;17(2):355-63
Endonuclease Gene Allele Fragments Strains
Bcl2 b 154bp C57BL/6J
c 132bp CBA/Ca
J:17613 Markel PD, et al., Mamm Genome. 1994 Apr;5(4):199-202
Endonuclease Gene Allele Fragments Strains
Bcl2 l 135bp LS
s 124bp SS
J:33375 Fleming J, et al., Genomics. 1996 Jun 1;34(2):205-12
Endonuclease Gene Allele Fragments Strains
Bcl2 b 154bp C57BL/10J
c 132bp CBA/Ca
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:4265 Nonaka M, et al., Molecular cloning of the b subunit of mouse coagulation factor XIII and assignment of the gene to chromosome 1: close evolutionary relationship to complement factor H. Genomics. 1993 Mar;15(3):535-42
J:13559 Goulding M, et al., Analysis of the Pax-3 gene in the mouse mutant splotch. Genomics. 1993 Aug;17(2):355-63
J:17613 Markel PD, et al., Initial characterization of STS markers in the LSXSS series of recombinant inbred strains. Mamm Genome. 1994 Apr;5(4):199-202
J:33375 Fleming J, et al., The Sp4H deletion may contain a new locus essential for postimplantation development. Genomics. 1996 Jun 1;34(2):205-12

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory