24.MMBCL2 Primer Detail MGI Mouse MGI:305

24.MMBCL2 Primer Detail

Name

24.MMBCL2
Primer 1 Sequence

CATTATCAATGATGTACCATG
Primer 2 Sequence

GCAGTAAATAGCTGATTCGAC
ID

MGI:305
Product Size

132bp
Synonyms

24MMBCL2, MMBCL2

Bcl2

B cell leukemia/lymphoma 2

J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

Endonuclease	Gene	Allele	Fragments	Strains
	Bcl2	b	larger	B6.PL-Thy1^a, B10.H2^nod, C57BL/6J, M. spretus
	Bcl2	n	smaller	DBA/2J, NOD, NON

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Bcl2	a	largest	C57BL/6Pas, SPR/Smh
	b	2nd largest	129S2/SvPas, BALB/cPas, C3H/HePas, DBA/2Pas, DDK/Pas, STS/Pas
	c	3rd largest	SEG/Pas, SPE/Pas
	d	4th largest	PWK/Pas

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Bcl2	a	largest	B10.D2-H2^d/Nimr, C58/OlaCrc
	b	larger	C57L/J, NOD/Crc, NZW/Ola
	c	smaller	AKR/Nimr, CBA/CaCrc
	d	smallest	A/JCrc, BALB/cCrc, C3H/HeCrc

J:4265 Nonaka M, et al., Genomics. 1993 Mar;15(3):535-42

Notes: Genomic DNA was amplified via PCR, electrophoresed on a 20% polyacrylamide gel and viewed with ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
	Bcl2	h	not given	C3H/HeJ
	Bcl2	s	not given	M. spretus

J:13559 Goulding M, et al., Genomics. 1993 Aug;17(2):355-63

Endonuclease	Gene	Allele	Fragments	Strains
	Bcl2	b	154bp	C57BL/6J
	Bcl2	c	132bp	CBA/Ca

J:17613 Markel PD, et al., Mamm Genome. 1994 Apr;5(4):199-202

Endonuclease	Gene	Allele	Fragments	Strains
	Bcl2	l	135bp	LS
	Bcl2	s	124bp	SS

J:33375 Fleming J, et al., Genomics. 1996 Jun 1;34(2):205-12

Endonuclease	Gene	Allele	Fragments	Strains
	Bcl2	b	154bp	C57BL/10J
	Bcl2	c	132bp	CBA/Ca

J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

J:4265 Nonaka M, et al., Molecular cloning of the b subunit of mouse coagulation factor XIII and assignment of the gene to chromosome 1: close evolutionary relationship to complement factor H. Genomics. 1993 Mar;15(3):535-42

J:13559 Goulding M, et al., Analysis of the Pax-3 gene in the mouse mutant splotch. Genomics. 1993 Aug;17(2):355-63

J:17613 Markel PD, et al., Initial characterization of STS markers in the LSXSS series of recombinant inbred strains. Mamm Genome. 1994 Apr;5(4):199-202

J:33375 Fleming J, et al., The Sp4H deletion may contain a new locus essential for postimplantation development. Genomics. 1996 Jun 1;34(2):205-12

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23