About   Help   FAQ
22.MMTNFAB Primer Detail
Primers
  • Name
    22.MMTNFAB
  • Primer 1 Sequence
    TTCCTGTGGCGGCCTTATCAG
  • Primer 2 Sequence
    AGACAATGGGTAACAGAGGCA
  • ID
    MGI:303
  • Product Size
    135bp
  • Synonyms
    22MMTNFAB, MMTNFAB, T68
Genes
D17Nds3 DNA segment, Chr 17, Nuffield Department of Surgery 3
Lta lymphotoxin A
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Lta b larger B6.PL-Thy1a, C57BL/6J
n smaller B10.H2nod, DBA/2J, NOD, NON
s smallest M. spretus
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Lta a largest PWK/Pas
b 2nd largest C3H/HePas
c 3rd largest 129S2/SvPas, C57BL/6Pas, DDK/Pas, STS/Pas
d 4th largest BALB/cPas, DBA/2Pas
e 5th largest SEG/Pas, SPE/Pas, SPR/Smh
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Lta a largest C57L/J, NOD/Crc
b larger A/JCrc, C3H/HeCrc, C58/OlaCrc
c smaller AKR/Nimr, B10.D2-H2d/Nimr, BALB/cCrc, CBA/CaCrc, NZW/Ola
J:20144 Heine D, et al., Genomics. 1994 Sep 1;23(1):168-77
Endonuclease Gene Allele Fragments Strains
D17Nds3 a larger A.SW-H2s/Sn
b smallest B10.D2-Hc0 H2d H2-T18c/oSnJ
c smaller C3.NB-H2p, P/J
k largest B10.K-H2k
J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42
Endonuclease Gene Allele Fragments Strains
D17Nds3 n 140bp NOD/Shi, NON/Shi
t 145bp CTS/Shi
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Nds2 a 160bp BN/aW
b 150bp A.CA/W, AKR/W, CBA/W
c 134bp 129/SvW, C57BL/6W, C57BL/10W
d 126bp BALB/cW, BN/aW, DBA/2W
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:4113 Snoek M, et al., Three Hsp70 genes are located in the C4-H-2D region: possible candidates for the Orch-1 locus [published erratum appears in Genomics 1993 Aug;17(2):533]. Genomics. 1993 Feb;15(2):350-6
J:20144 Heine D, et al., Analysis of recombinational hot spots associated with the p haplotype of the mouse MHC. Genomics. 1994 Sep 1;23(1):168-77
J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory