About   Help   FAQ
18.MMKALL Primer Detail
Primers
  • Name
    18.MMKALL
  • Primer 1 Sequence
    ACAGTCATTAGTCATTCAAAC
  • Primer 2 Sequence
    TGGAGTACTTAGGTTGTGCTC
  • ID
    MGI:300
  • Product Size
    177bp
  • Synonyms
    18MMKALL, MMKALL
Genes
Klk1 kallikrein 1
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Klk1 c present B6.PL-Thy1a, B10.H2nod, C57BL/6J, CBA/J, DBA/2J, NOD, NON
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Klk1 a largest A/JCrc, BALB/cCrc, NZW/Ola
b larger AKR/Nimr, B10.D2-H2d/Nimr, C58/OlaCrc, CBA/CaCrc, NOD/Crc
c smaller C3H/HeCrc, C57L/J
J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76
Endonuclease Gene Allele Fragments Strains
Klk1 b smaller C57BL/6J
r larger RF/J
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory