About   Help   FAQ
T30 Primer Detail
Primers
  • Name
    T30
  • Primer 1 Sequence
    TCCTTGGAGTTAAAACTTGGA
  • Primer 2 Sequence
    AGATAAATTCAATGAGTCCTA
  • ID
    MGI:30
  • Product Size
    135bp
  • Synonyms
    TJ-2.106
Genes
D9Nds2 DNA segment, Chr 9, Nuffield Department of Surgery 2
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D9Nds2 h smallest B6.PL-Thy1a/SnJ, C57BL/6J, C57BL/10-H2g7
n large NON
o small AKR/J, DBA/2J, NOD
s larger M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D9Nds2 d 125bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
e 121bp B6.Cg-Lepob/+, C57BL/6J
f 130bp CAST/EiJ, LP/J
i 127bp NON/ShiLt
s 110bp SPRET/EiJ
J:12629 Nass SJ, et al., Mamm Genome. 1993;4(6):333-7
Endonuclease Gene Allele Fragments Strains
D9Nds2 b not given C57BL/6J
d not given DBA/2J
h not given C3H/HeJ
J:15208 Imai K, et al., Mamm Genome. 1993;4(10):560-4
Endonuclease Gene Allele Fragments Strains
D9Nds2 b 125,118bp C57BL/6J
t 130,125bp TKDU/DnJ
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D9Nds2 a larger AKR/J
b smallest C57BL/J, LG/J
s smaller SM/J
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D9Nds2 m 135bp MOLF/EiJ
s 150bp 129/Sv
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:12629 Nass SJ, et al., Mapping of the Mod-1 locus on mouse chromosome 9. Mamm Genome. 1993;4(6):333-7
J:15208 Imai K, et al., The genetic map around the tail kinks (tk) locus on mouse chromosome 9. Mamm Genome. 1993;4(10):560-4
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory