About   Help   FAQ
9.MMINT2 Primer Detail
Primers
  • Name
    9.MMINT2
  • Primer 1 Sequence
    GTGACAATACATTCCTGCTGT
  • Primer 2 Sequence
    CTCAGATCTTATCTCTAGCAC
  • ID
    MGI:291
  • Product Size
    161bp
  • Synonyms
    9MMINT2, MMINT2
Genes
Fgf3 fibroblast growth factor 3
Polymorphisms
J:10652 Love JM, et al., Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
Endonuclease Gene Allele Fragments Strains
Fgf3 b largest B6.PL-Thy1a, B10.H2nod, C57BL/6J, NOD, NON
d smallest DBA/2J
s smaller M. spretus
J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.
Endonuclease Gene Allele Fragments Strains
Fgf3 a largest B6.PL-Thy1a, C57BL/6J, C57BL/10-H2g7, NOD, NON
a' largest B10.BR-H2k2 H2-T18a/SgSnJ, BALB/c, NOD/LtCrc
b 2nd largest SPR
b' 2nd largest A, C3H/He, CBA/CaH-T(14;15)6Ca, DBA/2J
c 3rd largest DBA/2J
c' 3rd largest C58, MEV/1TyJ
J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9
Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.
Endonuclease Gene Allele Fragments Strains
Fgf3 a largest C57BL/6Pas, SEG/Pas, SPE/Pas
b 2nd largest C57BL/6Pas, SPR/Smh
c 3rd largest BALB/cPas, DDK/Pas
d 4th largest 129S2/SvPas, C3H/HePas, DBA/2Pas, STS/Pas
e 5th largest PWK/Pas
J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6
Endonuclease Gene Allele Fragments Strains
Fgf3 a largest AKR/Nimr, B10.D2-H2d/Nimr, BALB/cCrc, NOD/Crc
b larger A/JCrc, C3H/HeCrc, CBA/CaCrc, NZW/Ola
c smaller C57L/J, C58/OlaCrc
J:35903 Schleef M, et al., Mamm Genome. 1996 Oct;7(10):788
Endonuclease Gene Allele Fragments Strains
Fgf3 b 161bp C57BL/6
s 165bp M. spretus
References
J:10652 Love JM, et al., Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res. 1990 Jul 25;18(14):4123-30
J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82
J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9
J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6
J:35903 Schleef M, et al., The gene encoding sarcoplasmic reticulum calcium ATPase-1 (Atp2a1) maps to distal mouse chromosome 7. Mamm Genome. 1996 Oct;7(10):788

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory