About   Help   FAQ
Gus-s-pA, Gus-s-pB Primer Detail
Primers
  • Name
    Gus-s-pA, Gus-s-pB
  • Primer 1 Sequence
    GGATCCTGTGTCATTTGCATGTG
  • Primer 2 Sequence
    AACGTTTACACAGATAACATCCACG
  • ID
    MGI:27
  • Product Size
    206bp
Genes
Gusb glucuronidase, beta
Polymorphisms
J:13207 Sands MS, et al., Proc Natl Acad Sci U S A. 1993 Jul 15;90(14):6567-71
Notes: Genomic DNA was amplified via PCR, electrophoresed on a 12% polyacrylamide gel and viewed with ethidium bromide.
Endonuclease Gene Allele Fragments Strains
Gusb a 113.0bp B6.C-H2-Kbm1/ByBir-Gusbmps/J
b 114.0bp B6.C-H2-Kbm1/By
J:14807 Shellam GR, et al., Mouse Genome. 1993;91(3):572-574
Notes: The 206bp insert was detected when sequences flanking intron 4 were used as PCR primers.
Endonuclease Gene Allele Fragments Strains
Gusb a 283.0bp BALB/c
b 77.0bp C3.PRI-Oas1bFlv-r, C3H/HeJ, C57BL/6J
J:15968 Sangster MY, et al., J Virol. 1994 Jan;68(1):448-52
Endonuclease Gene Allele Fragments Strains
Gusb c 283.0bp BALB/c
r 77.0bp C3.RV
References
J:13207 Sands MS, et al., A single-base-pair deletion in the beta-glucuronidase gene accounts for the phenotype of murine mucopolysaccharidosis type VII. Proc Natl Acad Sci U S A. 1993 Jul 15;90(14):6567-71
J:14807 Shellam GR, et al., Characterisation of allelic forms at the retinal degeneration (rd) and beta-glucuronidase (Gus) loci for the mapping of the flavivirus resistance (Flv) gene on mouse chromosome 5. Mouse Genome. 1993;91(3):572-574
J:15968 Sangster MY, et al., Mapping the Flv locus controlling resistance to flaviviruses on mouse chromosome 5. J Virol. 1994 Jan;68(1):448-52

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory