Gus-s-pA, Gus-s-pB Primer Detail MGI Mouse MGI:27

Gus-s-pA, Gus-s-pB Primer Detail

Name

Gus-s-pA, Gus-s-pB
Primer 1 Sequence

GGATCCTGTGTCATTTGCATGTG
Primer 2 Sequence

AACGTTTACACAGATAACATCCACG
ID

MGI:27
Product Size

206bp

Gusb

glucuronidase, beta

J:13207 Sands MS, et al., Proc Natl Acad Sci U S A. 1993 Jul 15;90(14):6567-71

Notes: Genomic DNA was amplified via PCR, electrophoresed on a 12% polyacrylamide gel and viewed with ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
	Gusb	a	113.0bp	B6.C-H2-K^bm1/ByBir-Gusb^mps/J
	Gusb	b	114.0bp	B6.C-H2-K^bm1/By

J:14807 Shellam GR, et al., Mouse Genome. 1993;91(3):572-574

Notes: The 206bp insert was detected when sequences flanking intron 4 were used as PCR primers.

Endonuclease	Gene	Allele	Fragments	Strains
	Gusb	a	283.0bp	BALB/c
	Gusb	b	77.0bp	C3.PRI-Oas1b^Flv-r, C3H/HeJ, C57BL/6J

J:15968 Sangster MY, et al., J Virol. 1994 Jan;68(1):448-52

Endonuclease	Gene	Allele	Fragments	Strains
	Gusb	c	283.0bp	BALB/c
	Gusb	r	77.0bp	C3.RV

J:13207 Sands MS, et al., A single-base-pair deletion in the beta-glucuronidase gene accounts for the phenotype of murine mucopolysaccharidosis type VII. Proc Natl Acad Sci U S A. 1993 Jul 15;90(14):6567-71

J:14807 Shellam GR, et al., Characterisation of allelic forms at the retinal degeneration (rd) and beta-glucuronidase (Gus) loci for the mapping of the flavivirus resistance (Flv) gene on mouse chromosome 5. Mouse Genome. 1993;91(3):572-574

J:15968 Sangster MY, et al., Mapping the Flv locus controlling resistance to flaviviruses on mouse chromosome 5. J Virol. 1994 Jan;68(1):448-52

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23