About   Help   FAQ
F3, R6 Primer Detail
Primers
  • Name
    F3, R6
  • Primer 1 Sequence
    CCAAGCTGCAGACATTCTAGCACTC
  • Primer 2 Sequence
    CAACATCTGCCTTCACGTCGATCC
  • ID
    MGI:2670294
  • Product Size
    561bp
Genes
Rag1 recombination activating 1
Expression
  • Assay Results
    122
References
J:84781 Chun JJ, et al., The recombination activating gene-1 (RAG-1) transcript is present in the murine central nervous system. Cell. 1991 Jan 11;64(1):189-200
J:67011 Bain G, et al., E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell. 1994 Dec 2;79(5):885-92
J:33829 Makino Y, et al., Development of Valpha4+ NK T cells in the early stages of embryogenesis. Proc Natl Acad Sci U S A. 1996 Jun 25;93(13):6516-20
J:39086 Marcos MA, et al., Antigenic phenotype and gene expression pattern of lymphohemopoietic progenitors during early mouse ontogeny. J Immunol. 1997 Mar 15;158(6):2627-37
J:49918 Murray AM, et al., Cytokine gene expression in murine fetal intestine: potential for extrathymic T cell development. Cytokine. 1998 May;10(5):337-45
J:77246 Hicar MD, et al., Embryonic expression and regulation of the large zinc finger protein KRC. Genesis. 2002 May;33(1):8-20
J:121955 Baguma-Nibasheka M, et al., Microarray analysis of Myf5-/-:MyoD-/- hypoplastic mouse lungs reveals a profile of genes involved in pneumocyte differentiation. Histol Histopathol. 2007 May;22(5):483-95

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory