ERbeta-pA, ERbeta-pB Primer Detail MGI Mouse MGI:2655806

ERbeta-pA, ERbeta-pB Primer Detail

Name

ERbeta-pA, ERbeta-pB
Primer 1 Sequence

TACAGTCCTGCTGTGATGAACT
Primer 2 Sequence

ACTAGTAACAGGGCTGGCACA
ID

MGI:2655806
Region Covered

Nucleotides 10-31 and 262-282 of GenBank sequence AJ000220.
Product Size

273bp

Esr2

estrogen receptor 2 (beta)

Assay Results

48

AJ000220 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)

J:50754 Karolczak M, et al., Developmental sex differences in estrogen receptor-beta mRNA expression in the mouse hypothalamus/preoptic region. Neuroendocrinology. 1998 Oct;68(4):229-34

J:60130 Kuppers E, et al., Expression of estrogen receptor-alpha and beta mRNA in the developing and adult mouse striatum. Neurosci Lett. 1999 Dec 3;276(2):95-8

J:63372 Ivanova T, et al., Ontogenetic expression and sex differences of aromatase and estrogen receptor-alpha/beta mRNA in the mouse hippocampus. Cell Tissue Res. 2000 May;300(2):231-7

J:85725 Beyer C, et al., Ontogenetic expression of estrogen and progesterone receptors in the mouse lung. Biol Neonate. 2003;84(1):59-63

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23