Zfy-pG, Zfy-pH Primer Detail MGI Mouse MGI:2655583

About Help FAQ

Zfy-pG, Zfy-pH Primer Detail

Name

Zfy-pG, Zfy-pH
Primer 1 Sequence

TGAAGTCTGCAGTACTTGTCGTCATT
Primer 2 Sequence

TCACTCATCAAGACATGTTCAGGCA
ID

MGI:2655583

Zfy1	zinc finger protein 1, Y-linked
Zfy2	zinc finger protein 2, Y-linked

J:40018 Koopman P, et al., Zfy gene expression patterns are not compatible with a primary role in mouse sex determination. Nature. 1989 Dec 21-28;342(6252):940-2

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24