About   Help   FAQ
T27 Primer Detail
Primers
  • Name
    T27
  • Primer 1 Sequence
    GAGATCTTCCATACTCATATT
  • Primer 2 Sequence
    TAGATAGTGTTAACAGTGACC
  • ID
    MGI:256
  • Product Size
    220bp
  • Synonyms
    TJ-T33
Genes
D7Nds1 DNA segment, Chr 7, Nuffield Department of Surgery 1
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D7Nds1 h smaller C57BL/10-H2g7
k larger AKR
n large NOD, NON
p smallest B6.PL-Thy1a/SnJ, C57BL/6J, DBA/2J
s largest M. spretus
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D7Nds1 c 265bp C3H/HeJ
d 260bp A/J, DBA/2J
e 238bp B6.Cg-Lepob/+, C57BL/6J
f 301bp CAST/EiJ
i 247bp NOD/MrkTac, NON/ShiLt
s 270bp AKR/J, BALB/cJ, LP/J, SPRET/EiJ
J:16441 Yamada Y, et al., Cancer Res. 1994 Jan 15;54(2):403-7
Notes: PCR products were resolved by electrophoresis on a 4% agarose gel and visualized by ethidium bromide.
Endonuclease Gene Allele Fragments Strains
D7Nds1 n 247bp NFS/N
s 270bp SL/KhStmRbrc
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D7Nds1 a larger AKR/J, LG/J
b smaller C57BL/J
s smallest SM/J
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D7Nds1 m 225bp MOLF/EiJ
s 245bp 129/Sv
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D7Nds1 a 270bp AKR/W, BALB/cW
b 260bp A.CA/W
c 245bp 129/SvW
d 238bp BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:16441 Yamada Y, et al., Genetic predisposition to pre-B lymphomas in SL/Kh strain mice. Cancer Res. 1994 Jan 15;54(2):403-7
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory