T27 Primer Detail MGI Mouse MGI:256

T27 Primer Detail

Name

T27
Primer 1 Sequence

GAGATCTTCCATACTCATATT
Primer 2 Sequence

TAGATAGTGTTAACAGTGACC
ID

MGI:256
Product Size

220bp
Synonyms

TJ-T33

D7Nds1

DNA segment, Chr 7, Nuffield Department of Surgery 1

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D7Nds1	h	smaller	C57BL/10-H2^g7
	k	larger	AKR
	n	large	NOD, NON
	p	smallest	B6.PL-Thy1^a/SnJ, C57BL/6J, DBA/2J
	s	largest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D7Nds1	c	265bp	C3H/HeJ
	d	260bp	A/J, DBA/2J
	e	238bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	301bp	CAST/EiJ
	i	247bp	NOD/MrkTac, NON/ShiLt
	s	270bp	AKR/J, BALB/cJ, LP/J, SPRET/EiJ

J:16441 Yamada Y, et al., Cancer Res. 1994 Jan 15;54(2):403-7

Notes: PCR products were resolved by electrophoresis on a 4% agarose gel and visualized by ethidium bromide.

Endonuclease	Gene	Allele	Fragments	Strains
	D7Nds1	n	247bp	NFS/N
	D7Nds1	s	270bp	SL/KhStmRbrc

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D7Nds1	a	larger	AKR/J, LG/J
	b	smaller	C57BL/J
	s	smallest	SM/J

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Nds1	m	225bp	MOLF/EiJ
Not Specified	D7Nds1	s	245bp	129/Sv

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D7Nds1	a	270bp	AKR/W, BALB/cW
	b	260bp	A.CA/W
	c	245bp	129/SvW
	d	238bp	BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:16441 Yamada Y, et al., Genetic predisposition to pre-B lymphomas in SL/Kh strain mice. Cancer Res. 1994 Jan 15;54(2):403-7

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23