About   Help   FAQ
T1 Probe Detail
Nucleotide
Probe/Clone
  • Name
    T1
  • Sequence Type
    oligo
  • ID
    MGI:24227
  • Region Covered
    ACATCTTCAGGAAAAGAGAGCAA
  • Insert Size
    23bp
Source
  • Species
    mouse, laboratory
  • Tissue
    B-lymphocyte
  • Tissue Description
    transformed B-lymphocyte
Genes
Iapt11 intracisternal A particle, tumor specific 11
Iapt18 intracisternal A particle, tumor specific 18
Iapt19 intracisternal A particle, tumor specific 19
Iapt20 intracisternal A particle, tumor specific 20
Iapt9 intracisternal A particle, tumor specific 9
Iapt8 intracisternal A particle, tumor specific 8
Iapt6 intracisternal A particle, tumor specific 6
Iapt5 intracisternal A particle, tumor specific 5
Iapt4 intracisternal A particle, tumor specific 4
Iapt3 intracisternal A particle, tumor specific 3
Iapt26 intracisternal A particle, tumor specific 26
Iapt15 intracisternal A particle, tumor specific 15
Iapt12 intracisternal A particle, tumor specific 12
Iapt10 intracisternal A particle, tumor specific 10
Iapt1 intracisternal A particle, tumor specific 1
Polymorphisms
J:20038 Lueders KK, et al., Mamm Genome. 1994 Aug;5(8):473-8
Endonuclease Gene Allele Fragments Strains
HindIII Iapt1 b ~6.7kb C57BL/6J
s absent M. spretus
HindIII Iapt3 b ~7.0kb C57BL/6J
s absent M. spretus
HindIII Iapt4 b ~6.6kb C57BL/6J
s absent M. spretus
HindIII Iapt5 b ~6.8kb C57BL/6J
s absent M. spretus
HindIII Iapt6 b ~5.8kb C57BL/6J
s absent M. spretus
HindIII Iapt8 b ~5.4kb C57BL/6J
s absent M. spretus
HindIII Iapt9 b ~5.0kb C57BL/6J
s absent M. spretus
HindIII Iapt10 b ~4.2kb C57BL/6J
s absent M. spretus
HindIII Iapt11 b ~3.3kb C57BL/6J
s absent M. spretus
HindIII Iapt12 b ~3.2kb C57BL/6J
s absent M. spretus
HindIII Iapt15 b ~3.0kb C57BL/6J
s absent M. spretus
HindIII Iapt18 b ~2.5kb C57BL/6J
s absent M. spretus
HindIII Iapt19 b ~2.4kb C57BL/6J
s absent M. spretus
HindIII Iapt20 b ~1.9kb C57BL/6J
s absent M. spretus
HindIII Iapt26 b ~1.3kb C57BL/6J
s absent M. spretus
References
J:20038 Lueders KK, et al., Mapping of mouse intracisternal A-particle proviral markers in an interspecific backcross. Mamm Genome. 1994 Aug;5(8):473-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory