About   Help   FAQ
Tnfr1-pA, Tnfr1-pB Primer Detail
Primers
  • Name
    Tnfr1-pA, Tnfr1-pB
  • Primer 1 Sequence
    GAGCCACCAGAGACCAAGAA
  • Primer 2 Sequence
    GCCTTAGAGGTAGCAACAAA
  • ID
    MGI:240
Genes
Tnfrsf1a tumor necrosis factor receptor superfamily, member 1a
Polymorphisms
J:12633 Takao S, et al., Immunogenetics. 1993;37(3):199-203
Notes: Unique sequence flanking the microsatellite were synthesized to use in PCR amplification.
Endonuclease Gene Allele Fragments Strains
Tnfrsf1a a 171bp AKR, BALB/c, C3H, DBA/1, DBA/2, MRL, NOD, NON, NZW, P/J, SJL/J
b 193bp BXSB, C57BL/6, CBA, NZB, PL/J, SM/J
c 197bp M. m. musculus, SWR
m 173bp M. m. domesticus poschiavinus
s 149.0bp M. spretus
References
J:12633 Takao S, et al., Novel DNA polymorphism in the mouse tumor necrosis factor receptors type 1 and type 2. Immunogenetics. 1993;37(3):199-203

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory